The nucleotide sequence of 5S rRNA fromScenedesmus obliquus
نویسندگان
چکیده
منابع مشابه
The nucleotide sequence of 5S rRNA from Scenedesmus obliquus.
The nucleotide sequence of the cytoplasmic 5S ribosomal RNA from Scenedesmusobliquus has been determined using post-labelling techniques. The sequence is closely related to the 5S RNA sequence of Chlorella and contains all the areas of invariant sequence which appear to be conserved in plant cytoplasmic 5S RNA species.
متن کاملThe nucleotide sequence of 5S rRNA from Mycoplasma capricolum.
The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.
متن کاملNucleotide sequence of a human 5S rRNA gene.
A gene for human 5S rRNA has been cloned and sequenced. The gene was isolated on a 638 bp fragment (Fig. 1) from human placenta DNA by digestion with BamHI and Sad and cloning into a Bluescnpt M13 plasmid. A ^P-labelled SP6-transcript of a mouse pseudogene was used as a probe. The fragment has a restriction pattern identical to the pattern of the majority of human 5S rRNA genes, which are found...
متن کاملThe nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.
The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).
متن کاملNucleotide sequence of cytoplasmic 5S rRNA from a eukaryotic thermophilic unicellular alga, Cyanidium caldarium.
From a total RNA extract of Cyanidium caldarium (Cca) cells we isolated, by the use of polyacrylamide gel electrophoresis under denaturing conditions, cytoplasmic 5S rRNA and determined its primary and possible secondary structure (Figure 1). The Cca 5S rRNA (i) is 124 nt long, (ii) harbors, at the expected positions, both internal transcription signals characteristic of this class of RNA polym...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
ژورنال
عنوان ژورنال: Nucleic Acids Research
سال: 1982
ISSN: 0305-1048,1362-4962
DOI: 10.1093/nar/10.20.6389